?

Genetics and Genomics

Free Version

Upgrade subject to access all content

Moderate

DNA Primers and Mismatches

GENES-ZKMAMU

You have been using the following primer to amplify a section of DNA from a bacterial species:

5' ATGCGTACCGGTACGTACGTGCACCGC

However, now you come across four mutant colonies that have mutations in this region of the genome.

Which of the following would be LEAST likely to allow for PCR amplification using this primer? Note only one strand is shown.

A

5' TTGCGTACCGGTACGTACGTGCACCGC

B

5' ATGCGTACCTGTACGTACGTGCACCGC

C

5' ATGCGTACCGGTACGTTCGTGCACCGC

D

5' ATGCGTACCGGTACGTACGTGCACCCC