?

Genetics and Genomics

Free Version

Upgrade subject to access all content

Difficult

Identification of a 5'UTR

GENES-YFHHRI

You are given the following DNA sequence and are told it contains the first three codons of the gene as well as part of the 5' UTR.

5' GGTCGTAAGGAGGGCGGTTACGTGGCCTGG

From which TWO of the following genomes could this sequence have come from?

Think carefully about which genomes you can eliminate.

A

Human nuclear genome.

B

Human mitochondrial genome.

C

Fruitfly nuclear genome.

D

Bacterial genome.

E

Arabidopsis nuclear genome.