Genetics and Genomics

Free Version

Upgrade subject to access all content

Moderate

Using PCR to Amplify a DNA Sequence

GENES-RLBJ38

Using the primer "GCAGCAACTTTA," highlight the area of the sequence below that would be exponentially amplified.

Only one strand is shown in the 5' to 3' direction. This primer will anneal to two locations in the DNA sequence.

Highlight Answer(s) Below

ATGACTATAAGCGAAGCTCGTCTATCACCGCAAGTCAATCTTCTCCCAATAAAGAGGCACTCAAACGAAGAGGTAG AGGAGACTGCAGCGATTCTAAAAAAGCGTACTATAGATAATGAAAAGTGTAAAGACAGCGACCCTGGTTTTGGTT CCCTTCAAAGAAGGTTACTGCAGCAACTTTATGGCACACTTCCTACGGACGAAAAGATAATCTTCACATATTTACAA GATTGTCAACAAGAGATCGATAGAATCATTAAACAATCCATTATTCAGAAAGAGAGTCATTCAGTAATTCTCGTGG GGCCCAGACAAAGTTACAAAACATACTTATTAGACTATGAACTGTCTTTGTTGCAACAATCTTATAAAGAGCAGTTT ATAACTATCAGGTTGAATGGGTTTATTCACTCCGAACAAACAGCTATTAACGGTATAGCAACTCAATTGGAACAGC AGTTGCAGAAAATTCATGGCAGTGAAGAAAAAATTGACGATACTTCATTAGAGACTATTAGCAGTGGTTCTTTGAC AGAAGTGTTTGAGAAAATTCTTTTACTCTTAGATTCGACCACGATAAAGTTGCTGCAGACAAGAAATGAAGATAGT GGTGAGGTTGACAGAGAGAGTATAACAAAGATAACAGTTGTTTTTATATTCGATGAAATTGATACATTTGCTGGGC CTGTGAGGCAA