?

Genetics and Genomics

Free Version

Upgrade subject to access all content

Difficult

Using Restriction Enzymes to Construct a Plasmid

GENES-@4VNCB

You are preparing to insert a gene into a plasmid. Plasmids often contain a "multiple cloning site," which is a region that contains the sequences that many different restriction enzymes would recognize. The multiple cloning site of the plasmid you are using is as follows:

ACGACGTCGCTGGCCACGTACGCCCGGGTGGCCACGCCGCGGCCGC

The gene you are inserting is flanked by the following sequences:

CCATGGCCAGACGTCCCGGGCG…………TGGCCAGGCGCCGACGTCGCGGCCGCATAG

You need to choose the best restriction enzyme(s) to insert the gene into the plasmid. Assume the sequence of the gene (symbolized here by …………) does not contain matches to any of the restriction enzymes you are using.

In the restriction enzymes shown below, the DNA sequence that each recognizes​ is given. The space in the DNA sequence is the place where the enzyme would cut the DNA.

Which of the following enzymes would be BEST to use to insert the gene into the plasmid?

Select ALL that apply.

A

AatII GACGT C

B

MscI TGG CCA

C

NotI GC GGCCGC

D

BsiWI C GTACG

E

SfoI GGC GCC

F

XmaI C CCGGG