Limited access

Upgrade to access all content for this subject

Examine the following DNA sequences:

1) 5' AGGCGTAACCATAGGTTAGACA

2) 5' GGTCAGATTGGAAACCTATGGTT

3) 5' ATAGGTTTCCAATTGGCCAATTGGAA

If these DNA strands were added either by themselves or in combinations to tubes containing DNA polymerase, dNTPs (The four nucleotides in a form that can be added to elongating DNA) and a solution that allows the DNA polymerase reaction, which of the following would synthesize new DNA? Select ALL that apply.

A

Sequence 1 alone.

B

Sequence 2 alone.

C

Sequence 3 alone.

D

Sequence 1 and 2 mixed together.

E

Sequence 1 and 3 mixed together.

F

Sequence 2 and 3 mixed together.

Select an assignment template