Limited access

Upgrade to access all content for this subject

You have been using the following primer to amplify a section of DNA from a bacterial species:

5' ATGCGTACCGGTACGTACGTGCACCGC

However, now you come across four mutant colonies that have mutations in this region of the genome.

Which of the following would LEAST likely allow for PCR amplification using this primer? Note only one strand is shown.

A

5' TTGCGTACCGGTACGTACGTGCACCGC

B

5' ATGCGTACCTGTACGTACGTGCACCGC

C

5' ATGCGTACCGGTACGTTCGTGCACCGC

D

5' ATGCGTACCGGTACGTACGTGCACCCC

Select an assignment template