Limited access

Upgrade to access all content for this subject

Which TWO of the following sequences could NOT belong to an exon of an mRNA?

Be sure to think about what can and cannot be in an exon. Also, note that the sequences are not necessarily presented starting at the beginning of a codon, so be sure to think about reading frames.

All sequences are written 5' to 3'.

A

AUGGGCAUCGUACGUCGAUCGAUGCGAU

B

AGGUCUGAUCUGUAAUGUGACCAUAC

C

ATCCGTGTACCACGCGAACCGGAACAG

D

UGGAUUGCAUCCUACCCUAUCCUAU

E

GGUGUACAUCUGUCAGCGGAUACGGC

Select an assignment template