Limited access

Upgrade to access all content for this subject

The following sequence contains the beginning of an open reading frame. Highlight the three base sequence which most likely corresponds to the start codon of the open reading frame. Remember to consider all possible reading frames.

AATGACATGCTCGGTTGCGACCGACTGATGAAGGCATAATC

The open reading frame is quite large, but only a small portion is shown here. Also,​ note that only one strand is shown.

Highlight Answer(s) Below

AATGACATGCTCGGTTGCGACCGACTGATGAAGGCATAATC
Select an assignment template