Limited access

Upgrade to access all content for this subject

Using the primer "GCAGCAACTTTA," highlight the area of the sequence below that would be exponentially amplified.

Only one strand is shown in the 5' to 3' direction. This primer will anneal to two locations in the DNA sequence.

Highlight Answer(s) Below

ATGACTATAAGCGAAGCTCGTCTATCACCGCAAGTCAATCTTCTCCCAATAAAGAGGCACTCAAACGAAGAGGTAG AGGAGACTGCAGCGATTCTAAAAAAGCGTACTATAGATAATGAAAAGTGTAAAGACAGCGACCCTGGTTTTGGTT CCCTTCAAAGAAGGTTACTGCAGCAACTTTATGGCACACTTCCTACGGACGAAAAGATAATCTTCACATATTTACAA GATTGTCAACAAGAGATCGATAGAATCATTAAACAATCCATTATTCAGAAAGAGAGTCATTCAGTAATTCTCGTGG GGCCCAGACAAAGTTACAAAACATACTTATTAGACTATGAACTGTCTTTGTTGCAACAATCTTATAAAGAGCAGTTT ATAACTATCAGGTTGAATGGGTTTATTCACTCCGAACAAACAGCTATTAACGGTATAGCAACTCAATTGGAACAGC AGTTGCAGAAAATTCATGGCAGTGAAGAAAAAATTGACGATACTTCATTAGAGACTATTAGCAGTGGTTCTTTGAC AGAAGTGTTTGAGAAAATTCTTTTACTCTTAGATTCGACCACGATAAAGTTGCTGCAGACAAGAAATGAAGATAGT GGTGAGGTTGACAGAGAGAGTATAACAAAGATAACAGTTGTTTTTATATTCGATGAAATTGATACATTTGCTGGGC CTGTGAGGCAA
Select an assignment template